This article presents the study on the behaviour of a local apple variety ‘Măr dulce’ in the proc... more This article presents the study on the behaviour of a local apple variety ‘Măr dulce’ in the process of pollination with two valuable varieties that are found in the European assortment. It was studied the behavior in the pollination process of two hybrid combinations C1 ‘Măr dulce’ x ‘Orion’ and C2 ‘Măr dulce’ x ‘Bistrițean’ where the maternal parent is the old apple variety ‘Măr dulce’ and the paternal parent is represeted by pollen from the apple varieties ‘Orion’ and ‘Bistrițean’.This study provides a novelty for a future selection of elite genotypes for the production of hybrids with an increased resistance to Venturia inaequalis.The studies were conducted in the spring of 2019 and the controlled pollination method was used, which involves a number of steps as: pollen harvesting, pollen maturation, castration of the maternal parent, pollination when the ovarian exudate appears on the stigma and isolation of pollinated branches. After these steps, the number of linked flowers, t...
In the context of organic farming, the control of plant diseases is done by applying certain meth... more In the context of organic farming, the control of plant diseases is done by applying certain methods that, depending on the time and method of application, can be preventive and curative. Deposits are usually additional sources of infestation with diseases that begin in the orchard. This paper proposes laboratory cultures of pathogens such as Venturia inaequalis, Monilinia fructigena, Gloeosporium fructigenum, Botrytis cinerea, Penicilium expansum and Pezicula alba, in an attempt to limit the evolution of the diseases produced until the total cessation of evolution. After cultivation on MS culture medium enriched with vitamins and sucrose in a sterile manner, the pathogenic material is allowed to develop. After 6 days, treatments were made with colloidal silver and with a biopesticide solution based on essential oils made according to our own recipe. In both cases, the area of infection was considerably reduced, the best results being obtained, however, after the treatment with the ...
The studies carried out and shown in the present paper were performed for four cherry varieties: ... more The studies carried out and shown in the present paper were performed for four cherry varieties: ‘Hedelfinger’, ‘Stella’, ‘Boambe de Cotnari’ and ‘Durone di Vignola’. The storage capacity, the weight losses and the quality depreciations were measured as well. The fruits were stored in the following environment condition variants: V1 = modified atmosphere, at 2-3°C and 85-90% RH; V2 = modified atmosphere at 24 25°C and 80-85% RH; V3= cold storage, at 2-3°C and 75-80% RH; V4 = room temperature conditions at 24 – 25°C and 70-75% RH. The results obtained have proven the advantage of storing fruits in modified atmosphere, the storage durations ranging from 12 days for the ‘Boambe de Cotnari’ variety to 18 days for the ‘Durone di Vignolaʼ variety. The ‘Durone di Vignola’ variety has proven to have been the best preserved at the end of the storage period, the total losses recorded being of 2.3% in room temperature conditions after 8 days and only 9.2% after 18 days of storage in modified a...
Breeding for fruit resistant to pests and diseases has become a major objective for many research... more Breeding for fruit resistant to pests and diseases has become a major objective for many research laboratories. Excessive use of pesticides is increasingly denounced by consumers and the rules controlling their use (particularly with respect to toxic residues) are increasingly restricting. The use of resistant cultivars reduces production costs and increases workers safety. Prospecting through Romanian apricot collections has leaded us to the discovery of several sources of resistance to Sharka. The different Romanian hybrids or local apricot varieties was chosen among the different sources of resistance as it could also be used to develop a weeping variety in the some breeding program. To start with, the resistance mode of heritability was studied by creating F1 generations from the resistant parent crossed with a sensitive one, Mari de Cenad The resistance character is dominant and monogenic (symbols Rm1/m1). Breeding was continued by creating the F2 generations using by resistanc...
Sharka disease, caused by this virus (PPV) is one of the most serious viral diseases of stone-fru... more Sharka disease, caused by this virus (PPV) is one of the most serious viral diseases of stone-fruit crops, including peach (Prunus persica L.), apricot (P. armeniaca L.), plums (P. domestica L. and P. salicina Lindl.) as well as sweet and sour cherries (P. avium L. and P. cerasus L.) that may be systemically infected by a few unique PPV strains. The goal of this work is to evaluate a large number of local apricot varieties concerninhg the resitance to PPV, and using them on the valuable breeding programs, is an interesting perspective in limiting the spread of th is virus. In support of this idea we studied a large number of genotypes grafted on the mirobolan rootstocks and GF305 (considered indicator to PPV), that were previously artificial infected with PPV by chip budding. The rootstocks and the apricot varieties were tested by Elisa and RT-PCR.
The blueberry has become a species more and more cultivated in all favourable crop areas, especia... more The blueberry has become a species more and more cultivated in all favourable crop areas, especially in the northern hemisphere. The interest shown in this plant is given by the nutritional and sanogenic importance of its fruits, well used as fresh fruits or processed in various forms. The crop technology of blueberry is relatively simple, but the species is very particular on the soil reaction and its drainage, as these plants are sensitive to certain specific diseases. The fructification cutting is done with different intensities to ensure a large production, quality and continuance in time. In order to test the reaction of four blueberry varieties: ‘Duke’, ‘Draper’, ‘Patriot’ and ‘Brigitta’, the plants were cut at two different intensities and it was observed that a more intensive cutting influenced the height of the bush and the total sum of growth and also the maturation of fruits was slightly anticipated. The size of fruits was favourably pushed by the intensity of cutting, ho...
For apricot fruits an important problem is to define the optimal picking time, the best storage v... more For apricot fruits an important problem is to define the optimal picking time, the best storage variant and the variety availability for storage as to avoid having different quality levels between on–tree and in-store maturity. In response to this problem and some others that may arise, the research was performed in the orchard of the University of Agronomic Sciences and Veterinary Medicine of Bucharest. Early results have revealed that fruits from 9 apricot cultivars evaluated towards maturity in all the storage variants: NA-normal atmosphere (T=26°C), CA-cold atmosphere (T=23°C, relative humidity 78 to 83%) and MA-modified atmosphere (T=2-3°C, relative humidity 85 to 90%) by wrapping the storage case in plastic film. The MA storage variant may be positively considered since the total losses (both in quantity and quality) were lower than in the NA and CA variants. The best response to temporary storage was found in the late maturing varieties ʻFavoritʼ, ʻOlimpʼ and ʻExcelsiorʼ and ...
Sharka (Plum pox) is considered one of the most devastating diseases of stone fruits in terms of ... more Sharka (Plum pox) is considered one of the most devastating diseases of stone fruits in terms of agronomic impact and economic importance. The response of several apricot hybrids was evaluated over the vegetative period of 2010 by visual monitoring of symptom development and by serological and molecular methods. After two cycles of study, all the replicates of ‘Mari de Cenad’, ‘Traian’ and ‘Tabriz’ showed sharka symptoms while the replicates of ‘Stark Early Orange’ and NJA 2 did not show any symptoms and were not ELISA-positive. The resistant progenitors (‘Stark Early Orange’, NJA17, NJA42 and NJA2) were able to transmit PPV resistance to their descendants, in agreement with previous results (DOSBA et al, 1994, MARTINEZ-GOMEZ et al, 2000; AUDERGON et al, 1994). The genetic control hypotheses for PPV resistance in apricot referenced by different authors considered the resistance allele as dominant. Romanian apricot F1 and F2 progenies evaluated were classified into two groups: suscep...
Using the process of breeding, the native apple varieties well adapted to the climate of Romania ... more Using the process of breeding, the native apple varieties well adapted to the climate of Romania can be an interesting premise for inducing natural genetic resistance to Venturia inaequalis. This paper aims to study in detail the terms of phenological and molecular tools a few Romanian old apple varieties, ('Prescurate', 'Gurguiate', 'S�� lciu', 'Venchi', 'Turnu', 'Calvil alb', 'Sângeriu', 'Iridium' etc) who showed in prior in the field conditions a natural genetic resistance to scab and after these studies could be reconsidered and reassessed in new breeding programs in Romania. For the beginning the screening with molecular markers to highlight the presence or absence of Vf gene, is the first step in reconsidering these old varieties of apple.
Plum pox virus (PPV) is a devastating stone fruit disease of major importance, and better underst... more Plum pox virus (PPV) is a devastating stone fruit disease of major importance, and better understanding of the genetic control of resistance to this trait would be useful for more efficient development of resistant cultivars. Previous studies have reported a locus major effect from PPV resistance on linkage group 1. The hybrids were grafted simultaneously and subsequently inoculated with the PPV-M and D strains. The symptom scoring on leaves was performed three times over two vegetative cycles. The PPV resistant loci were mapped using composite interval mapping (CIM).This paper presents data from PhD thesis part of the project POSDRU/107/1.5/S/76888, funded by European Social Fund through the Sectorial Operational Programme Human Resources Development 2007-2013.
For the success of the blueberry culture, certain conditions are necessary to be fulfilled, espec... more For the success of the blueberry culture, certain conditions are necessary to be fulfilled, especially the soil reaction which must be acid (pH=4,5-5,5), the soil must be properly drained, having a high content in organic material. In order to test the reaction of certain blueberry varieties to the Bucharest area conditions, where the soil is not totally suitable for this culture, an experiment was conducted with 6 varieties and 4 different methods of work ing the soil on the rows (bark, sawdust, agrotextile and grass) to ensure conditions as good as possible for the growth of the plants. For th e planting, 10 liters of acid peat were used to correct the acidity of the soil. The biometric parameters analyzed for the plants highlighted, on one hand, differences among varieties, and on the other hand, differences am ong the soil maintenance variants. The varieties Pemberton and Bluecrop were more vigorous, while the varieties Delicia and Simultan proved to have a lower vigor. Also the...
The quality of apple fruits is influenced by variety and within each variety by the rootstock and... more The quality of apple fruits is influenced by variety and within each variety by the rootstock and by the culture technology applied. The research presented in this paper highlighted the influence of the rootstock on the fruit quality. The experiment was conducted during 2016-2017 in the Vâlcea plant nursery, in Romania, as a comparative study for the ʻPinovaʼ variety with several rootstocks (M9, B9, M20, Pi80, M106), including variants with grafting interstems (B9/A2, B9/M111). The size of the fruit was larger for the trees grafted on the rootstock B9 with the interstem M111, while the firmness was positively influenced by the rootstocks M9 and B9/A2. The content of soluble dry substance was favourably influenced by the rootstocks M20, B9 and Pi 80, while the titratable acidity had higher values for the fruits produced by the trees grafted on M106 and M9/M111. The total anthocyanins content was higher for the fruits obtained from the trees grafted on the rootstock B9 with the inters...
High pressure liquid chromatographic (HPLC) methods were used for measurement of vitamin C and or... more High pressure liquid chromatographic (HPLC) methods were used for measurement of vitamin C and organic acid changes of forty old Romanian apple cultivars (“Prescurate”,“Gurguiate”,“Zori”,“Carla”,“Mohorat”, “Trotuse”, “Mere Tari”,”Mar Orbai” etc.) during cold storage. Harvested apples at the last stage of commercial ripeness were placed in perforated stored at 0°C temperature and 90-95% relative humidity for 60 days. Vitamin C content decreased in all cultivars but no significant differences were found in the most important of them from the beginning to the end of the storage. The highest share of total acids was contributed by citric acid. The high level of vitamin C was measured in the cultivars” Trotuse”, “Ancuta”,”Wachsman Sammeling”and “Wachsman Amalie”. Malic acid content of cultivars also decreased with storage time. Tartaric, oxalic and fumaric acid contents fluctuated during storage, but at the end of cold storage these organic acids had decreased in comparison to initial va...
Crown shape plays a very important role in ensuring proper lightning conditions for the branches ... more Crown shape plays a very important role in ensuring proper lightning conditions for the branches and fruit; it ensures different exposure conditions for the leaves and influences their synthesis capacity, while also permitting the formation of the fruit branches and support of the production. Depending on the plant management system, the planting distances vary for the same vigor of the variety – rootstock combination. The plant management system with five crown shapes determined differences in what regards the biometric parameters of the trees, the quantity of wood removed when pruning, fruit production, degree of illumination of the branches, intensity of the photosynthesis and respiration and fruit quality. Tree crowns which recorded better productivity values were managed as interrupted pyramid and fruit cylinder, while regarding the quality values the vessel bush and interrupted pyramid proved better choices. The best leaf exposure was recorded for the trees managed as vessel b...
Bulletin of University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca: Horticulture, 2009
Abstract. Three genotypes of Prunus (Mirobolan BN 4Kr – a mutant of Prunus cerasifera , Local de ... more Abstract. Three genotypes of Prunus (Mirobolan BN 4Kr – a mutant of Prunus cerasifera , Local de Drăgăsani – a selection of Prunus insititia , and Cacanska Najbolia cv. - Prunus domestica ) were evaluated for PPV resistance based on their response to PPV-D and PPV-Rec strains, after inoculation by budding. Both PPV-D and PPV-Rec strains were translocated from the inoculum buds to Myrobolan BN 4Kr but the virus was able to induce only a limited infection, indicating a possible inhibition of virus replication. The response of Local de Drăgăsani to inoculation with the two PPV strains revealed a typical hypersensitivity reaction which could be a promising natural resistance source to PPV. The infection with both D and Rec strains became systemic in Cacanska Najbolia and no evidence of an effective inhibition of virus replication. Keywords : plum, resistance, hypersensitivity, strains, PPV- D, PPV-Rec. INTRODUCTION Plum pox virus (PPV) is the causal agent of Sharka, one of the most deva...
Scab infection caused by Venturia inaequalis (Cke.) Wint. is one of the most serious diseases of ... more Scab infection caused by Venturia inaequalis (Cke.) Wint. is one of the most serious diseases of apple reported from almost all apple producing countries and causes huge economic losses (up to 70% reduction in apple production). The infection leads to deformation in shape and size of the fruits, premature leaf and fruit fall, and enhances susceptibility of tree to chilling and freezing injuries. An new breeding programme in apple trees was started in spring 2009 at the University of Agronomical Science and Veterinary Medecine Bucharest. Plant breeding experience assured that recovery of fruit quality will be accomplished, whereas disease-resistance breeding experience was not so reassuring with respect to obtaining permanent disease resistance. The molecular genetics offers the promise of improving our understanding of the nature of plant resistance genes.The biological material is the maternal and paternal genitor used sexual hybridization came from natural pollination of the spur variety like Bolero, Waltz, Polka, and the resistance one (Piors, Enterprise, Braeburn, Galaxy, Remo).
The plum pox virus produces an extremely damaging disease in fruit stone species with major impli... more The plum pox virus produces an extremely damaging disease in fruit stone species with major implications in fruit production but also in phytosanitary status of fruit plantation. The genome of the virus encodes a single large polyprotein, a precursor that determines the serological properties of PPV, namely CP (Coat protein). This poly protein is proteolytically catalyzed by 3 viral encoding proteases that can synthesize up to 10 functional proteins. The capsid protein binds to the carboxyl end of the polyprotein. The in vitro properties of the viral extract vary with the strain and the plants used for propagation. Establishing the best primers for the molecular detection of the Plum pox virus is an extremely important stage, so a bioinformatics analysis it’s necessary to identify potential sources of results misconduct (sources of contamination that can produce false positive results) is taken into account. The detection primers P1 5 ACCGAGACCATCACCCTCCC 3 and P2 – 5 CAGACTACACCGTC...
Sharka caused by Plum pox virus (PPV) is considered to be one of the most devastating diseases in... more Sharka caused by Plum pox virus (PPV) is considered to be one of the most devastating diseases in Prunus species such as peach, plum, apricot, and cherry. The spreading of PPV might be limited by planting PPV resistant or at least less-susceptible rootstocks on which PPV resistant scions have been grafted. Certain apricot cultivars (‘Stark Early Orange’, ‘Traian’, ‘NJA 21’) display significant levels of resistance to the disease. In the last eighth years, at USAMV Bucharest, Romania, unfolds a breeding program aiming to develop cultivars and rootstocks resistant to PPV and an efficient procedure for the determination of sharka resistance within the progenies was established. The GF305 rootstocks were grafted with apricot individuals originating from crossing between a PPV resistant genitor (e.g. ‘SEO’, ‘NJA2’ “NJA 17, NJA 42) and Romanian preferred varieties. Grafted plants were inoculated by chip-budding and monitored by visual inspection and ELISA, completed by RT-PCR for the PPV ...
The apple scab disease has probably evolved over a long time along with the apples. The disease i... more The apple scab disease has probably evolved over a long time along with the apples. The disease is caused by the fungus Venturia inaequalis (Cke.) Wint, anamorph Spilocaea pomi Fr. The aim of this study were the isolation and quantification the genomic DNA on old Romanian varieties in order to select the most important to them for the Marker Assisted Selections (MAS) on apple trees. This paper presents the results of DNA isolation by exploring local populations of apple like ‘Prescurate’, ‘Seghese’, ‘Vieşti’ and ‘Kniş’ apples old varieties, that are well adapted to the conditions in Romania and that are un interesting genetic potential for resistance to scab. Only the old apple varieties were used in the study. The implementation of marker selection depends on the quality and quantity of isolated genomic DNA. The results of the quantification performed following genomic DNA isolation show a large variability in the amount of DNA in each old apple variety. The DNA concentration in ap...
Fungal plant pathogens belonging to the genus Venturia cause damaging scab diseases of members of... more Fungal plant pathogens belonging to the genus Venturia cause damaging scab diseases of members of the Rosaceae. In terms of economic impact, the most important of these are Venturia inaequalis, which infects apple, and Venturia pirina, which is a pathogen of European pear. Given that Venturia fungi colonise the sub-cuticular space without penetrating plant cells, it is assumed that effectors that contribute to virulence and determination of host range will be secreted into this plant-pathogen interface. The use of resistance varieties in the pollination process is an important way to obtain varieties with genetic resistance to disease. In this paper were used as mother genitors some selections from Pyrus serotina (‘9/34-94’, ‘20/1-91’ and ‘5/104-84’) with genetic resistance to diseases and pests and as father genitors (pollen) two valuable varieties of the European assortment (‘Williams’, ‘Beuré Bosc’) and ‘Cristal’ cv. Romanian pear variety registered in 2009 at Research Station fo...
This article presents the study on the behaviour of a local apple variety ‘Măr dulce’ in the proc... more This article presents the study on the behaviour of a local apple variety ‘Măr dulce’ in the process of pollination with two valuable varieties that are found in the European assortment. It was studied the behavior in the pollination process of two hybrid combinations C1 ‘Măr dulce’ x ‘Orion’ and C2 ‘Măr dulce’ x ‘Bistrițean’ where the maternal parent is the old apple variety ‘Măr dulce’ and the paternal parent is represeted by pollen from the apple varieties ‘Orion’ and ‘Bistrițean’.This study provides a novelty for a future selection of elite genotypes for the production of hybrids with an increased resistance to Venturia inaequalis.The studies were conducted in the spring of 2019 and the controlled pollination method was used, which involves a number of steps as: pollen harvesting, pollen maturation, castration of the maternal parent, pollination when the ovarian exudate appears on the stigma and isolation of pollinated branches. After these steps, the number of linked flowers, t...
In the context of organic farming, the control of plant diseases is done by applying certain meth... more In the context of organic farming, the control of plant diseases is done by applying certain methods that, depending on the time and method of application, can be preventive and curative. Deposits are usually additional sources of infestation with diseases that begin in the orchard. This paper proposes laboratory cultures of pathogens such as Venturia inaequalis, Monilinia fructigena, Gloeosporium fructigenum, Botrytis cinerea, Penicilium expansum and Pezicula alba, in an attempt to limit the evolution of the diseases produced until the total cessation of evolution. After cultivation on MS culture medium enriched with vitamins and sucrose in a sterile manner, the pathogenic material is allowed to develop. After 6 days, treatments were made with colloidal silver and with a biopesticide solution based on essential oils made according to our own recipe. In both cases, the area of infection was considerably reduced, the best results being obtained, however, after the treatment with the ...
The studies carried out and shown in the present paper were performed for four cherry varieties: ... more The studies carried out and shown in the present paper were performed for four cherry varieties: ‘Hedelfinger’, ‘Stella’, ‘Boambe de Cotnari’ and ‘Durone di Vignola’. The storage capacity, the weight losses and the quality depreciations were measured as well. The fruits were stored in the following environment condition variants: V1 = modified atmosphere, at 2-3°C and 85-90% RH; V2 = modified atmosphere at 24 25°C and 80-85% RH; V3= cold storage, at 2-3°C and 75-80% RH; V4 = room temperature conditions at 24 – 25°C and 70-75% RH. The results obtained have proven the advantage of storing fruits in modified atmosphere, the storage durations ranging from 12 days for the ‘Boambe de Cotnari’ variety to 18 days for the ‘Durone di Vignolaʼ variety. The ‘Durone di Vignola’ variety has proven to have been the best preserved at the end of the storage period, the total losses recorded being of 2.3% in room temperature conditions after 8 days and only 9.2% after 18 days of storage in modified a...
Breeding for fruit resistant to pests and diseases has become a major objective for many research... more Breeding for fruit resistant to pests and diseases has become a major objective for many research laboratories. Excessive use of pesticides is increasingly denounced by consumers and the rules controlling their use (particularly with respect to toxic residues) are increasingly restricting. The use of resistant cultivars reduces production costs and increases workers safety. Prospecting through Romanian apricot collections has leaded us to the discovery of several sources of resistance to Sharka. The different Romanian hybrids or local apricot varieties was chosen among the different sources of resistance as it could also be used to develop a weeping variety in the some breeding program. To start with, the resistance mode of heritability was studied by creating F1 generations from the resistant parent crossed with a sensitive one, Mari de Cenad The resistance character is dominant and monogenic (symbols Rm1/m1). Breeding was continued by creating the F2 generations using by resistanc...
Sharka disease, caused by this virus (PPV) is one of the most serious viral diseases of stone-fru... more Sharka disease, caused by this virus (PPV) is one of the most serious viral diseases of stone-fruit crops, including peach (Prunus persica L.), apricot (P. armeniaca L.), plums (P. domestica L. and P. salicina Lindl.) as well as sweet and sour cherries (P. avium L. and P. cerasus L.) that may be systemically infected by a few unique PPV strains. The goal of this work is to evaluate a large number of local apricot varieties concerninhg the resitance to PPV, and using them on the valuable breeding programs, is an interesting perspective in limiting the spread of th is virus. In support of this idea we studied a large number of genotypes grafted on the mirobolan rootstocks and GF305 (considered indicator to PPV), that were previously artificial infected with PPV by chip budding. The rootstocks and the apricot varieties were tested by Elisa and RT-PCR.
The blueberry has become a species more and more cultivated in all favourable crop areas, especia... more The blueberry has become a species more and more cultivated in all favourable crop areas, especially in the northern hemisphere. The interest shown in this plant is given by the nutritional and sanogenic importance of its fruits, well used as fresh fruits or processed in various forms. The crop technology of blueberry is relatively simple, but the species is very particular on the soil reaction and its drainage, as these plants are sensitive to certain specific diseases. The fructification cutting is done with different intensities to ensure a large production, quality and continuance in time. In order to test the reaction of four blueberry varieties: ‘Duke’, ‘Draper’, ‘Patriot’ and ‘Brigitta’, the plants were cut at two different intensities and it was observed that a more intensive cutting influenced the height of the bush and the total sum of growth and also the maturation of fruits was slightly anticipated. The size of fruits was favourably pushed by the intensity of cutting, ho...
For apricot fruits an important problem is to define the optimal picking time, the best storage v... more For apricot fruits an important problem is to define the optimal picking time, the best storage variant and the variety availability for storage as to avoid having different quality levels between on–tree and in-store maturity. In response to this problem and some others that may arise, the research was performed in the orchard of the University of Agronomic Sciences and Veterinary Medicine of Bucharest. Early results have revealed that fruits from 9 apricot cultivars evaluated towards maturity in all the storage variants: NA-normal atmosphere (T=26°C), CA-cold atmosphere (T=23°C, relative humidity 78 to 83%) and MA-modified atmosphere (T=2-3°C, relative humidity 85 to 90%) by wrapping the storage case in plastic film. The MA storage variant may be positively considered since the total losses (both in quantity and quality) were lower than in the NA and CA variants. The best response to temporary storage was found in the late maturing varieties ʻFavoritʼ, ʻOlimpʼ and ʻExcelsiorʼ and ...
Sharka (Plum pox) is considered one of the most devastating diseases of stone fruits in terms of ... more Sharka (Plum pox) is considered one of the most devastating diseases of stone fruits in terms of agronomic impact and economic importance. The response of several apricot hybrids was evaluated over the vegetative period of 2010 by visual monitoring of symptom development and by serological and molecular methods. After two cycles of study, all the replicates of ‘Mari de Cenad’, ‘Traian’ and ‘Tabriz’ showed sharka symptoms while the replicates of ‘Stark Early Orange’ and NJA 2 did not show any symptoms and were not ELISA-positive. The resistant progenitors (‘Stark Early Orange’, NJA17, NJA42 and NJA2) were able to transmit PPV resistance to their descendants, in agreement with previous results (DOSBA et al, 1994, MARTINEZ-GOMEZ et al, 2000; AUDERGON et al, 1994). The genetic control hypotheses for PPV resistance in apricot referenced by different authors considered the resistance allele as dominant. Romanian apricot F1 and F2 progenies evaluated were classified into two groups: suscep...
Using the process of breeding, the native apple varieties well adapted to the climate of Romania ... more Using the process of breeding, the native apple varieties well adapted to the climate of Romania can be an interesting premise for inducing natural genetic resistance to Venturia inaequalis. This paper aims to study in detail the terms of phenological and molecular tools a few Romanian old apple varieties, ('Prescurate', 'Gurguiate', 'S�� lciu', 'Venchi', 'Turnu', 'Calvil alb', 'Sângeriu', 'Iridium' etc) who showed in prior in the field conditions a natural genetic resistance to scab and after these studies could be reconsidered and reassessed in new breeding programs in Romania. For the beginning the screening with molecular markers to highlight the presence or absence of Vf gene, is the first step in reconsidering these old varieties of apple.
Plum pox virus (PPV) is a devastating stone fruit disease of major importance, and better underst... more Plum pox virus (PPV) is a devastating stone fruit disease of major importance, and better understanding of the genetic control of resistance to this trait would be useful for more efficient development of resistant cultivars. Previous studies have reported a locus major effect from PPV resistance on linkage group 1. The hybrids were grafted simultaneously and subsequently inoculated with the PPV-M and D strains. The symptom scoring on leaves was performed three times over two vegetative cycles. The PPV resistant loci were mapped using composite interval mapping (CIM).This paper presents data from PhD thesis part of the project POSDRU/107/1.5/S/76888, funded by European Social Fund through the Sectorial Operational Programme Human Resources Development 2007-2013.
For the success of the blueberry culture, certain conditions are necessary to be fulfilled, espec... more For the success of the blueberry culture, certain conditions are necessary to be fulfilled, especially the soil reaction which must be acid (pH=4,5-5,5), the soil must be properly drained, having a high content in organic material. In order to test the reaction of certain blueberry varieties to the Bucharest area conditions, where the soil is not totally suitable for this culture, an experiment was conducted with 6 varieties and 4 different methods of work ing the soil on the rows (bark, sawdust, agrotextile and grass) to ensure conditions as good as possible for the growth of the plants. For th e planting, 10 liters of acid peat were used to correct the acidity of the soil. The biometric parameters analyzed for the plants highlighted, on one hand, differences among varieties, and on the other hand, differences am ong the soil maintenance variants. The varieties Pemberton and Bluecrop were more vigorous, while the varieties Delicia and Simultan proved to have a lower vigor. Also the...
The quality of apple fruits is influenced by variety and within each variety by the rootstock and... more The quality of apple fruits is influenced by variety and within each variety by the rootstock and by the culture technology applied. The research presented in this paper highlighted the influence of the rootstock on the fruit quality. The experiment was conducted during 2016-2017 in the Vâlcea plant nursery, in Romania, as a comparative study for the ʻPinovaʼ variety with several rootstocks (M9, B9, M20, Pi80, M106), including variants with grafting interstems (B9/A2, B9/M111). The size of the fruit was larger for the trees grafted on the rootstock B9 with the interstem M111, while the firmness was positively influenced by the rootstocks M9 and B9/A2. The content of soluble dry substance was favourably influenced by the rootstocks M20, B9 and Pi 80, while the titratable acidity had higher values for the fruits produced by the trees grafted on M106 and M9/M111. The total anthocyanins content was higher for the fruits obtained from the trees grafted on the rootstock B9 with the inters...
High pressure liquid chromatographic (HPLC) methods were used for measurement of vitamin C and or... more High pressure liquid chromatographic (HPLC) methods were used for measurement of vitamin C and organic acid changes of forty old Romanian apple cultivars (“Prescurate”,“Gurguiate”,“Zori”,“Carla”,“Mohorat”, “Trotuse”, “Mere Tari”,”Mar Orbai” etc.) during cold storage. Harvested apples at the last stage of commercial ripeness were placed in perforated stored at 0°C temperature and 90-95% relative humidity for 60 days. Vitamin C content decreased in all cultivars but no significant differences were found in the most important of them from the beginning to the end of the storage. The highest share of total acids was contributed by citric acid. The high level of vitamin C was measured in the cultivars” Trotuse”, “Ancuta”,”Wachsman Sammeling”and “Wachsman Amalie”. Malic acid content of cultivars also decreased with storage time. Tartaric, oxalic and fumaric acid contents fluctuated during storage, but at the end of cold storage these organic acids had decreased in comparison to initial va...
Crown shape plays a very important role in ensuring proper lightning conditions for the branches ... more Crown shape plays a very important role in ensuring proper lightning conditions for the branches and fruit; it ensures different exposure conditions for the leaves and influences their synthesis capacity, while also permitting the formation of the fruit branches and support of the production. Depending on the plant management system, the planting distances vary for the same vigor of the variety – rootstock combination. The plant management system with five crown shapes determined differences in what regards the biometric parameters of the trees, the quantity of wood removed when pruning, fruit production, degree of illumination of the branches, intensity of the photosynthesis and respiration and fruit quality. Tree crowns which recorded better productivity values were managed as interrupted pyramid and fruit cylinder, while regarding the quality values the vessel bush and interrupted pyramid proved better choices. The best leaf exposure was recorded for the trees managed as vessel b...
Bulletin of University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca: Horticulture, 2009
Abstract. Three genotypes of Prunus (Mirobolan BN 4Kr – a mutant of Prunus cerasifera , Local de ... more Abstract. Three genotypes of Prunus (Mirobolan BN 4Kr – a mutant of Prunus cerasifera , Local de Drăgăsani – a selection of Prunus insititia , and Cacanska Najbolia cv. - Prunus domestica ) were evaluated for PPV resistance based on their response to PPV-D and PPV-Rec strains, after inoculation by budding. Both PPV-D and PPV-Rec strains were translocated from the inoculum buds to Myrobolan BN 4Kr but the virus was able to induce only a limited infection, indicating a possible inhibition of virus replication. The response of Local de Drăgăsani to inoculation with the two PPV strains revealed a typical hypersensitivity reaction which could be a promising natural resistance source to PPV. The infection with both D and Rec strains became systemic in Cacanska Najbolia and no evidence of an effective inhibition of virus replication. Keywords : plum, resistance, hypersensitivity, strains, PPV- D, PPV-Rec. INTRODUCTION Plum pox virus (PPV) is the causal agent of Sharka, one of the most deva...
Scab infection caused by Venturia inaequalis (Cke.) Wint. is one of the most serious diseases of ... more Scab infection caused by Venturia inaequalis (Cke.) Wint. is one of the most serious diseases of apple reported from almost all apple producing countries and causes huge economic losses (up to 70% reduction in apple production). The infection leads to deformation in shape and size of the fruits, premature leaf and fruit fall, and enhances susceptibility of tree to chilling and freezing injuries. An new breeding programme in apple trees was started in spring 2009 at the University of Agronomical Science and Veterinary Medecine Bucharest. Plant breeding experience assured that recovery of fruit quality will be accomplished, whereas disease-resistance breeding experience was not so reassuring with respect to obtaining permanent disease resistance. The molecular genetics offers the promise of improving our understanding of the nature of plant resistance genes.The biological material is the maternal and paternal genitor used sexual hybridization came from natural pollination of the spur variety like Bolero, Waltz, Polka, and the resistance one (Piors, Enterprise, Braeburn, Galaxy, Remo).
The plum pox virus produces an extremely damaging disease in fruit stone species with major impli... more The plum pox virus produces an extremely damaging disease in fruit stone species with major implications in fruit production but also in phytosanitary status of fruit plantation. The genome of the virus encodes a single large polyprotein, a precursor that determines the serological properties of PPV, namely CP (Coat protein). This poly protein is proteolytically catalyzed by 3 viral encoding proteases that can synthesize up to 10 functional proteins. The capsid protein binds to the carboxyl end of the polyprotein. The in vitro properties of the viral extract vary with the strain and the plants used for propagation. Establishing the best primers for the molecular detection of the Plum pox virus is an extremely important stage, so a bioinformatics analysis it’s necessary to identify potential sources of results misconduct (sources of contamination that can produce false positive results) is taken into account. The detection primers P1 5 ACCGAGACCATCACCCTCCC 3 and P2 – 5 CAGACTACACCGTC...
Sharka caused by Plum pox virus (PPV) is considered to be one of the most devastating diseases in... more Sharka caused by Plum pox virus (PPV) is considered to be one of the most devastating diseases in Prunus species such as peach, plum, apricot, and cherry. The spreading of PPV might be limited by planting PPV resistant or at least less-susceptible rootstocks on which PPV resistant scions have been grafted. Certain apricot cultivars (‘Stark Early Orange’, ‘Traian’, ‘NJA 21’) display significant levels of resistance to the disease. In the last eighth years, at USAMV Bucharest, Romania, unfolds a breeding program aiming to develop cultivars and rootstocks resistant to PPV and an efficient procedure for the determination of sharka resistance within the progenies was established. The GF305 rootstocks were grafted with apricot individuals originating from crossing between a PPV resistant genitor (e.g. ‘SEO’, ‘NJA2’ “NJA 17, NJA 42) and Romanian preferred varieties. Grafted plants were inoculated by chip-budding and monitored by visual inspection and ELISA, completed by RT-PCR for the PPV ...
The apple scab disease has probably evolved over a long time along with the apples. The disease i... more The apple scab disease has probably evolved over a long time along with the apples. The disease is caused by the fungus Venturia inaequalis (Cke.) Wint, anamorph Spilocaea pomi Fr. The aim of this study were the isolation and quantification the genomic DNA on old Romanian varieties in order to select the most important to them for the Marker Assisted Selections (MAS) on apple trees. This paper presents the results of DNA isolation by exploring local populations of apple like ‘Prescurate’, ‘Seghese’, ‘Vieşti’ and ‘Kniş’ apples old varieties, that are well adapted to the conditions in Romania and that are un interesting genetic potential for resistance to scab. Only the old apple varieties were used in the study. The implementation of marker selection depends on the quality and quantity of isolated genomic DNA. The results of the quantification performed following genomic DNA isolation show a large variability in the amount of DNA in each old apple variety. The DNA concentration in ap...
Fungal plant pathogens belonging to the genus Venturia cause damaging scab diseases of members of... more Fungal plant pathogens belonging to the genus Venturia cause damaging scab diseases of members of the Rosaceae. In terms of economic impact, the most important of these are Venturia inaequalis, which infects apple, and Venturia pirina, which is a pathogen of European pear. Given that Venturia fungi colonise the sub-cuticular space without penetrating plant cells, it is assumed that effectors that contribute to virulence and determination of host range will be secreted into this plant-pathogen interface. The use of resistance varieties in the pollination process is an important way to obtain varieties with genetic resistance to disease. In this paper were used as mother genitors some selections from Pyrus serotina (‘9/34-94’, ‘20/1-91’ and ‘5/104-84’) with genetic resistance to diseases and pests and as father genitors (pollen) two valuable varieties of the European assortment (‘Williams’, ‘Beuré Bosc’) and ‘Cristal’ cv. Romanian pear variety registered in 2009 at Research Station fo...
Uploads
Papers by Ligia ION