Dipyridamole, a coronary vasodilatator, was found to possess antiviral activity against represent... more Dipyridamole, a coronary vasodilatator, was found to possess antiviral activity against representatives of different families. The antiviral properties were studied in chick embryo, human diplid and FL cell cultures by the agar diffusion plaque inhibition and plaque reduction tests and one-step growth cycle experiments. The inhibition of the virus-induced cytopathic effect was estimated quantitatively. Dipyridamole significantly inhibited the yield of members of the viral families Picornaviridae, Togaviridae, Orthomyxoviridae, Paramyxoviridae, Herpetoviridae and Poxviridae, as well as of Chlamydiaceae (sheep abortion agent).
In an ethnopharmacological screening, plants used in Nepalese traditional medicine were evaluated... more In an ethnopharmacological screening, plants used in Nepalese traditional medicine were evaluated for antiviral activity. Methanolic and methanolic-aqueous extracts derived of 23 species were assayed in two in vitro viral systems, influenza virus/MDCK cells and herpes simplex virus/Vero cells. Two species, Bergenia ligulata and Nerium indicum showed the highest antiinfluenzaviral activity with 50% inhibitory dose of 10 mg/ml. Holoptelia integrifolia and N. indicum exhibited considerable antiviral activity against herpes simplex virus. None of these extracts showed cytotoxic effects. Additionally for B. ligulata and H. integrifolia partial protease inhibitory activity was estimated.
The fiber knob of adenovirus (Ad) causes the first step in the interaction of adenovirus with cel... more The fiber knob of adenovirus (Ad) causes the first step in the interaction of adenovirus with cell membrane receptors. To obtain information on the receptor binding site(s) several synthetic peptides derived from Ad2 and Ad3 fiber head sequences and their antisera were tested for interference with virus attachment to HeLa and FL cells and cell adhesion to viruses. The anti-peptide sera were also evaluated in ELISA and virus neutralisation test. Ad2 (of subgroup C) and Ad3 (of subgroup B) attachment was not significantly inhibited by peptides corresponding to the amino acid residues 535 554, 555-573, 562-582 of Ad2 fiber or 210-225, 267-283, 291-306 and 300-319 of Ad3 fiber. However, microplate pre-adsorbed Ad3 fiber residues 210 225 and 267 283 could bind FL and HeLa cells, and 1 mg/ml of Ad3 fiber residues 267-283 inhibited the cell adhesion to Ad3 virus to approximately 90%. This peptide may participate in the receptor binding site of Ad3 fiber. ELISA reactive anti-peptide antibodies against the homologous peptide and virus did not significantly reduce the cell adhesion to the immobilised virus or the virus attachment to cells, but in the neutralisation assay antibodies raised to Ad2 fiber residues 555-573 and 562-582 and Ad3 fiber residues 210-225 caused neutralisation of the homologous virus at serum dilutions of 1:500 and 1:32, respectively. The corresponding peptides and one further peptide of Ad2 fiber and two of Ad3 fiber seem to contain neutralisation epitopes.
Respiratory syncytial virus (RSV) is one of the most important virus respiratory pathogens in inf... more Respiratory syncytial virus (RSV) is one of the most important virus respiratory pathogens in infants and young children. A rapid and sensitive diagnosis is essential to focus any outbreak due to this virus. A real-time RT-PCR method was designed using a primer/probe pair from the F gene. Simultaneously with nested RT-PCR and antigen ELISA, 71 consecutive specimens from hospitalized children with clinical symptoms of acute respiratory distress were evaluated to confirm the incidence of RSV infection. RSV was detected in 25 (35•2 %) specimens by real-time RT-PCR and in 19 (26•7 %) by nested RT-PCR. The assay was specific for RSV. The procedure offers a rapid and sensitive alternative to conventional RT-PCR. Closed-tube detection eliminates the risk of contamination.
Linear antigenic epitopes on the Ad5 fibre knob (FK5) were characterised with fibre-and virion-sp... more Linear antigenic epitopes on the Ad5 fibre knob (FK5) were characterised with fibre-and virion-specific antisera, using 15-mer overlapping peptides covering the knob of the fibre. They were compared with epitopes on the Ad2 fibre knob (FK2) domain. The stronger reactive FK5 epitopes were represented by peptides P3 (amino acids (aa A419-L433)), P6 (aa S449-E463), P7 (aa I459-L473), P12 (aa G509-N523), P14 (aa P529-G543) and P16 (aa A549-Y563). P3 spans the B b-strand and the left portion of the C b-strand, P6 and P7 the D b-strand and the adjacent parts of the CD and DE loops, P12, P14 and P16 the G, H and I b strands and the adjacent parts of the loops, respectively. The stronger reactive epitopes on FK2 were located in P2 (aa P409-L423), P6 (aa T449-Q463), P8 (aa E469-G483), P13 (aa Q519-T533) and P16 (aa S549-K563). The positions of FK5 and FK2 derived peptides, representing epitopes, are either identical or overlapping or adjacent, as determined by amino acid sequence alignment. Antisera obtained against several longer peptides showed virus neutralising capacity, indicating neutralising epitopes in these peptides.
Four sterols and 10 triterpenes were isolated from the fruiting bodies of Ganoderma pfeifferi, in... more Four sterols and 10 triterpenes were isolated from the fruiting bodies of Ganoderma pfeifferi, including the three new triterpenes 3,7,11-trioxo-5R-lanosta-8,24-diene-26-al (lucialdehyde D, 1), 5R-lanosta-8,24diene-26-hydroxy-3,7-dione (ganoderone A, 2), and 5R-lanosta-8-ene-24,25-epoxy-26-hydroxy-3,7-dione (ganoderone C, 3). The structures of 1-3 were determined on the basis of spectroscopic evidence. Antibacterial, antifungal, and antiviral activity were studied for some of the isolated compounds. Ganoderone A (2), lucialdehyde B (4), and ergosta-7,22-dien-3-ol (7) were found to exhibit potent inhibitory activity against herpes simplex virus.
Measles virus infection is associated with a profound, transient suppression of cell-mediated imm... more Measles virus infection is associated with a profound, transient suppression of cell-mediated immunity. A live-attenuated virus vaccine has been used to control measles infection in industrialized countries since 1963. The efficacy of the vaccine and the unique biological features of the virus have made it a target for global eradication by the World Health Organization.The target for eradication in Europe is the year 2007 [1]. Although measles virus remains monotypic, nucleotide sequence analyses have identified distinct lineages among wild-type isolates [2-4]. The majority of genotypes seems to be restricted to particular geographical areas [5].The circulation of two distinct genotypes, C2 and D6, in Germany between 1993 and 1996 has been demonstrated [6]. Investigation of measles cases in different parts of Europe has shown Central and Western Europe to be a qualitatively uniform region concerning the circulation of genetic groups of measles virus [5, 6]. The increase in worldwide travel may contribute to the importation of geographically restricted virus groups into countries that have succeeded in decreasing morbidity. In this report a cluster of measles infection in northeastern Germany is presented. 25 cases of measles were identified between February 6 and April 28, 2000. The analysis included 23 patients who were hospitalized during the outbreak and two further cases with a moderate course that did not lead to hospitalization. An ELISA was performed to detect antibodies to measles (Dade Behring, Germany).Vero cells were used for virus isolation.A nested PCR was performed using a primer set located in the variable part of the N gene, MN1 (nt 1196-1217, 5'ATTAGGGCAAGAGATGGTAAGG3'), MN2 (nt 1739-1722, 5'TATAACAATGATGGAGGG3') and MN3 (nt 1233-1254, 5'GTCAGTTCCACATTRGCAT-CTG3') and MN4 (nt 1648-1631, 5'GTGTCCGTGTCT-GAGCCT3') [5, 6]. DNA fragments were analyzed by automatic DNA sequencing (ABI PRISM 310 Genetic Analyzer, Perkin-Elmer, Germany). Data regarding episodes of hospitalization and the results of laboratory diagnosis are shown in table 1.The most common causes for hospitalization were high fever and acute respiratory failure, occasionally accompanied by ex
The adenovirus fiber knob causes the first step in the interaction of adenovirus with cell membra... more The adenovirus fiber knob causes the first step in the interaction of adenovirus with cell membrane receptors. To obtain information on the receptor binding site(s), the interaction of labeled cell membrane proteins to synthetic peptides covering the adenovirus type 3 (Ad3) fiber knob was studied. Peptide P6 (amino acids [aa] 187 to 200), to a lesser extent P14 (aa 281 to 294), and probably P11 (aa 244 to 256) interacted specifically with cell membrane proteins, indicating that these peptides present cell receptor binding sites. Peptides P6, P11, and P14 span the D, G, and I -strands of the R-sheet, respectively. The other reactive peptides, P2 (aa 142 to 156), P3 (aa 153 to 167), and P16 (aa 300 to 319), probably do not present real receptor binding sites. The binding to these six peptides was inhibited by Ad3 virion and was independent of divalent cations. We have also screened the antigenic epitopes on the knob with recombinant Ad3 fiber, recombinant Ad3 fiber knob, and Ad3 virion-specific antisera by enzyme-linked immunosorbent assay. The main antigenic epitopes were presented by P3, P6, P12 (aa 254 to 269), P14, and especially the C-terminal P16. Peptides P14 and P16 of the Ad3 fiber knob were able to inhibit Ad3 infection of cells.
Patients with cystic fibrosis (CF) now have a considerably prolonged life span; survival to 35-40... more Patients with cystic fibrosis (CF) now have a considerably prolonged life span; survival to 35-40 years is no longer unusual. 1,2 As a consequence, CF patients often suffer from late complications such as diabetes mellitus, chronic arthropathy, chronic liver diseases (fibrosis, cirrhosis), and unusual infections with Mycobacterium tuberculosis, atypical mycobacteria, and fungi. 3,4 We observed a 25-year-old male CF patient suffering from multiple brain abscesses and purulent meningitis, who has survived and completely recovered following antibiotic, antimycobacterial, and antimycotic drug therapy. The young man had been receiving standard CF therapy since the age of 3 years. 5 At the age of 15 years a spleno-renal shunt operation (WARREN shunt) was performed for relapsing esophageal bleeding from esophageal varices secondary to an interahepatic bloc and liver fibrosis. He had hypersplenism as indicated by splenomegaly and pronounced neutropenia and thrombocytopenia. After surgery, the gastrointestinal bleeding stopped and the blood values normalized. During recent years, type I diabetes mellitus and chronic hemoptysis especially from the right upper lung lobe have developed. 6 In April 1995 the patient was seen because of headache and vomiting. The cerebrospinal fluid (CSF) showed 1,000 cells/mm 3 (71% neutrophils) with inclusions, suspected to be ingested bacteria (Fig. 1). No bacterial, mycobacterial, viral, or fungal agents could be identified in the CSF. Polymerase chain reaction (PCR) for bovine and human M. tuberculosis and herpes simplex virus in the CSF was negative, and large-scale PCR tests for Pseudomonas aeruginosa, Pseudomonas cepacia, and S. maltophilia in the CSF were also negative. In the bloody sputum we found different strains of P. aeruginosa susceptible to several antibiotics, a multiresistant P. cepacia, Staphylococcus aureus with normal susceptibility, Candida albicans, and Mycobacterium fortuitum, resistant to isoniazid, ethambutol, rifampicin, pyrazinamide, and prothionamide. Blood tests documented a recent seroconversion for adenovirus, RSV and influenza virus A and B. Antibodies against the patient's Ps.aeruginosa were found in the serum with a titer of 1:20, and in the CSF with a titer of 1:2,560.
Lymphocytes play a key role in cell-mediated immunity and are host cells for several viral and ba... more Lymphocytes play a key role in cell-mediated immunity and are host cells for several viral and bacterial pathogens. Their importance in adenovirus (Ad) infections is not yet fully understood. The initial event, the attachment of Ad to lymphocytes and their subsets, was examined using flow cytometry. The study included analysis of stimulated T cells in binding assays with FITC-labeled Ad fiber. The results confirm that native peripheral lymphocytes express very small amounts of Ad receptors. Stimulation with PHA and interleukin 2 induced the expression. The presence of Ad DNA as a sign of internalization in stimulated cells was demonstrated using the polymerase chain reaction. The findings suggest that lymphocytes after stimulation can turn into target cells for Ad. This is particularly important if there are indications for persistence of Ad, and in the case of immunocompromised patients severe, life-threatening diseases can develop.
Dipyridamole, a coronary vasodilatator, was found to possess antiviral activity against represent... more Dipyridamole, a coronary vasodilatator, was found to possess antiviral activity against representatives of different families. The antiviral properties were studied in chick embryo, human diplid and FL cell cultures by the agar diffusion plaque inhibition and plaque reduction tests and one-step growth cycle experiments. The inhibition of the virus-induced cytopathic effect was estimated quantitatively. Dipyridamole significantly inhibited the yield of members of the viral families Picornaviridae, Togaviridae, Orthomyxoviridae, Paramyxoviridae, Herpetoviridae and Poxviridae, as well as of Chlamydiaceae (sheep abortion agent).
In an ethnopharmacological screening, plants used in Nepalese traditional medicine were evaluated... more In an ethnopharmacological screening, plants used in Nepalese traditional medicine were evaluated for antiviral activity. Methanolic and methanolic-aqueous extracts derived of 23 species were assayed in two in vitro viral systems, influenza virus/MDCK cells and herpes simplex virus/Vero cells. Two species, Bergenia ligulata and Nerium indicum showed the highest antiinfluenzaviral activity with 50% inhibitory dose of 10 mg/ml. Holoptelia integrifolia and N. indicum exhibited considerable antiviral activity against herpes simplex virus. None of these extracts showed cytotoxic effects. Additionally for B. ligulata and H. integrifolia partial protease inhibitory activity was estimated.
The fiber knob of adenovirus (Ad) causes the first step in the interaction of adenovirus with cel... more The fiber knob of adenovirus (Ad) causes the first step in the interaction of adenovirus with cell membrane receptors. To obtain information on the receptor binding site(s) several synthetic peptides derived from Ad2 and Ad3 fiber head sequences and their antisera were tested for interference with virus attachment to HeLa and FL cells and cell adhesion to viruses. The anti-peptide sera were also evaluated in ELISA and virus neutralisation test. Ad2 (of subgroup C) and Ad3 (of subgroup B) attachment was not significantly inhibited by peptides corresponding to the amino acid residues 535 554, 555-573, 562-582 of Ad2 fiber or 210-225, 267-283, 291-306 and 300-319 of Ad3 fiber. However, microplate pre-adsorbed Ad3 fiber residues 210 225 and 267 283 could bind FL and HeLa cells, and 1 mg/ml of Ad3 fiber residues 267-283 inhibited the cell adhesion to Ad3 virus to approximately 90%. This peptide may participate in the receptor binding site of Ad3 fiber. ELISA reactive anti-peptide antibodies against the homologous peptide and virus did not significantly reduce the cell adhesion to the immobilised virus or the virus attachment to cells, but in the neutralisation assay antibodies raised to Ad2 fiber residues 555-573 and 562-582 and Ad3 fiber residues 210-225 caused neutralisation of the homologous virus at serum dilutions of 1:500 and 1:32, respectively. The corresponding peptides and one further peptide of Ad2 fiber and two of Ad3 fiber seem to contain neutralisation epitopes.
Respiratory syncytial virus (RSV) is one of the most important virus respiratory pathogens in inf... more Respiratory syncytial virus (RSV) is one of the most important virus respiratory pathogens in infants and young children. A rapid and sensitive diagnosis is essential to focus any outbreak due to this virus. A real-time RT-PCR method was designed using a primer/probe pair from the F gene. Simultaneously with nested RT-PCR and antigen ELISA, 71 consecutive specimens from hospitalized children with clinical symptoms of acute respiratory distress were evaluated to confirm the incidence of RSV infection. RSV was detected in 25 (35•2 %) specimens by real-time RT-PCR and in 19 (26•7 %) by nested RT-PCR. The assay was specific for RSV. The procedure offers a rapid and sensitive alternative to conventional RT-PCR. Closed-tube detection eliminates the risk of contamination.
Linear antigenic epitopes on the Ad5 fibre knob (FK5) were characterised with fibre-and virion-sp... more Linear antigenic epitopes on the Ad5 fibre knob (FK5) were characterised with fibre-and virion-specific antisera, using 15-mer overlapping peptides covering the knob of the fibre. They were compared with epitopes on the Ad2 fibre knob (FK2) domain. The stronger reactive FK5 epitopes were represented by peptides P3 (amino acids (aa A419-L433)), P6 (aa S449-E463), P7 (aa I459-L473), P12 (aa G509-N523), P14 (aa P529-G543) and P16 (aa A549-Y563). P3 spans the B b-strand and the left portion of the C b-strand, P6 and P7 the D b-strand and the adjacent parts of the CD and DE loops, P12, P14 and P16 the G, H and I b strands and the adjacent parts of the loops, respectively. The stronger reactive epitopes on FK2 were located in P2 (aa P409-L423), P6 (aa T449-Q463), P8 (aa E469-G483), P13 (aa Q519-T533) and P16 (aa S549-K563). The positions of FK5 and FK2 derived peptides, representing epitopes, are either identical or overlapping or adjacent, as determined by amino acid sequence alignment. Antisera obtained against several longer peptides showed virus neutralising capacity, indicating neutralising epitopes in these peptides.
Four sterols and 10 triterpenes were isolated from the fruiting bodies of Ganoderma pfeifferi, in... more Four sterols and 10 triterpenes were isolated from the fruiting bodies of Ganoderma pfeifferi, including the three new triterpenes 3,7,11-trioxo-5R-lanosta-8,24-diene-26-al (lucialdehyde D, 1), 5R-lanosta-8,24diene-26-hydroxy-3,7-dione (ganoderone A, 2), and 5R-lanosta-8-ene-24,25-epoxy-26-hydroxy-3,7-dione (ganoderone C, 3). The structures of 1-3 were determined on the basis of spectroscopic evidence. Antibacterial, antifungal, and antiviral activity were studied for some of the isolated compounds. Ganoderone A (2), lucialdehyde B (4), and ergosta-7,22-dien-3-ol (7) were found to exhibit potent inhibitory activity against herpes simplex virus.
Measles virus infection is associated with a profound, transient suppression of cell-mediated imm... more Measles virus infection is associated with a profound, transient suppression of cell-mediated immunity. A live-attenuated virus vaccine has been used to control measles infection in industrialized countries since 1963. The efficacy of the vaccine and the unique biological features of the virus have made it a target for global eradication by the World Health Organization.The target for eradication in Europe is the year 2007 [1]. Although measles virus remains monotypic, nucleotide sequence analyses have identified distinct lineages among wild-type isolates [2-4]. The majority of genotypes seems to be restricted to particular geographical areas [5].The circulation of two distinct genotypes, C2 and D6, in Germany between 1993 and 1996 has been demonstrated [6]. Investigation of measles cases in different parts of Europe has shown Central and Western Europe to be a qualitatively uniform region concerning the circulation of genetic groups of measles virus [5, 6]. The increase in worldwide travel may contribute to the importation of geographically restricted virus groups into countries that have succeeded in decreasing morbidity. In this report a cluster of measles infection in northeastern Germany is presented. 25 cases of measles were identified between February 6 and April 28, 2000. The analysis included 23 patients who were hospitalized during the outbreak and two further cases with a moderate course that did not lead to hospitalization. An ELISA was performed to detect antibodies to measles (Dade Behring, Germany).Vero cells were used for virus isolation.A nested PCR was performed using a primer set located in the variable part of the N gene, MN1 (nt 1196-1217, 5'ATTAGGGCAAGAGATGGTAAGG3'), MN2 (nt 1739-1722, 5'TATAACAATGATGGAGGG3') and MN3 (nt 1233-1254, 5'GTCAGTTCCACATTRGCAT-CTG3') and MN4 (nt 1648-1631, 5'GTGTCCGTGTCT-GAGCCT3') [5, 6]. DNA fragments were analyzed by automatic DNA sequencing (ABI PRISM 310 Genetic Analyzer, Perkin-Elmer, Germany). Data regarding episodes of hospitalization and the results of laboratory diagnosis are shown in table 1.The most common causes for hospitalization were high fever and acute respiratory failure, occasionally accompanied by ex
The adenovirus fiber knob causes the first step in the interaction of adenovirus with cell membra... more The adenovirus fiber knob causes the first step in the interaction of adenovirus with cell membrane receptors. To obtain information on the receptor binding site(s), the interaction of labeled cell membrane proteins to synthetic peptides covering the adenovirus type 3 (Ad3) fiber knob was studied. Peptide P6 (amino acids [aa] 187 to 200), to a lesser extent P14 (aa 281 to 294), and probably P11 (aa 244 to 256) interacted specifically with cell membrane proteins, indicating that these peptides present cell receptor binding sites. Peptides P6, P11, and P14 span the D, G, and I -strands of the R-sheet, respectively. The other reactive peptides, P2 (aa 142 to 156), P3 (aa 153 to 167), and P16 (aa 300 to 319), probably do not present real receptor binding sites. The binding to these six peptides was inhibited by Ad3 virion and was independent of divalent cations. We have also screened the antigenic epitopes on the knob with recombinant Ad3 fiber, recombinant Ad3 fiber knob, and Ad3 virion-specific antisera by enzyme-linked immunosorbent assay. The main antigenic epitopes were presented by P3, P6, P12 (aa 254 to 269), P14, and especially the C-terminal P16. Peptides P14 and P16 of the Ad3 fiber knob were able to inhibit Ad3 infection of cells.
Patients with cystic fibrosis (CF) now have a considerably prolonged life span; survival to 35-40... more Patients with cystic fibrosis (CF) now have a considerably prolonged life span; survival to 35-40 years is no longer unusual. 1,2 As a consequence, CF patients often suffer from late complications such as diabetes mellitus, chronic arthropathy, chronic liver diseases (fibrosis, cirrhosis), and unusual infections with Mycobacterium tuberculosis, atypical mycobacteria, and fungi. 3,4 We observed a 25-year-old male CF patient suffering from multiple brain abscesses and purulent meningitis, who has survived and completely recovered following antibiotic, antimycobacterial, and antimycotic drug therapy. The young man had been receiving standard CF therapy since the age of 3 years. 5 At the age of 15 years a spleno-renal shunt operation (WARREN shunt) was performed for relapsing esophageal bleeding from esophageal varices secondary to an interahepatic bloc and liver fibrosis. He had hypersplenism as indicated by splenomegaly and pronounced neutropenia and thrombocytopenia. After surgery, the gastrointestinal bleeding stopped and the blood values normalized. During recent years, type I diabetes mellitus and chronic hemoptysis especially from the right upper lung lobe have developed. 6 In April 1995 the patient was seen because of headache and vomiting. The cerebrospinal fluid (CSF) showed 1,000 cells/mm 3 (71% neutrophils) with inclusions, suspected to be ingested bacteria (Fig. 1). No bacterial, mycobacterial, viral, or fungal agents could be identified in the CSF. Polymerase chain reaction (PCR) for bovine and human M. tuberculosis and herpes simplex virus in the CSF was negative, and large-scale PCR tests for Pseudomonas aeruginosa, Pseudomonas cepacia, and S. maltophilia in the CSF were also negative. In the bloody sputum we found different strains of P. aeruginosa susceptible to several antibiotics, a multiresistant P. cepacia, Staphylococcus aureus with normal susceptibility, Candida albicans, and Mycobacterium fortuitum, resistant to isoniazid, ethambutol, rifampicin, pyrazinamide, and prothionamide. Blood tests documented a recent seroconversion for adenovirus, RSV and influenza virus A and B. Antibodies against the patient's Ps.aeruginosa were found in the serum with a titer of 1:20, and in the CSF with a titer of 1:2,560.
Lymphocytes play a key role in cell-mediated immunity and are host cells for several viral and ba... more Lymphocytes play a key role in cell-mediated immunity and are host cells for several viral and bacterial pathogens. Their importance in adenovirus (Ad) infections is not yet fully understood. The initial event, the attachment of Ad to lymphocytes and their subsets, was examined using flow cytometry. The study included analysis of stimulated T cells in binding assays with FITC-labeled Ad fiber. The results confirm that native peripheral lymphocytes express very small amounts of Ad receptors. Stimulation with PHA and interleukin 2 induced the expression. The presence of Ad DNA as a sign of internalization in stimulated cells was demonstrated using the polymerase chain reaction. The findings suggest that lymphocytes after stimulation can turn into target cells for Ad. This is particularly important if there are indications for persistence of Ad, and in the case of immunocompromised patients severe, life-threatening diseases can develop.
Uploads
Papers by Renate Mentel